Blog

Nov 06, 2024

Optimization of a novel expression system for recombinant protein production in CHO cells | Scientific Reports

Scientific Reports volume 14, Article number: 24913 (2024) Cite this article 1075 Accesses Metrics details Chinese hamster ovary (CHO) cells are common mammalian cell lines for expressing recombinant

Scientific Reports volume 14, Article number: 24913 (2024) Cite this article

1075 Accesses

Metrics details

Chinese hamster ovary (CHO) cells are common mammalian cell lines for expressing recombinant proteins, yet the expression level of recombinant proteins is still hindered. Vector optimization and cell line modification are the key factors to improve the expression of recombinant proteins. In this study, the vector was optimized by adding the regulatory elements Kozak and Leader to the upstream of target gene to detect the transient and stable expression of recombinant proteins. Results indicated that the expression level of target proteins with the addition of regulatory elements was significantly increased compared with the control group. In addition, the inhibition of apoptotic pathway has great potential to increase recombinant protein production, and Apaf1 protein dependent on the mitochondrial apoptosis pathway plays an important role in this respect. The knockout of apoptotic gene Apaf1 in CHO cells can also increase recombinant protein production. Therefore, the vector was optimized by adding regulatory elements, and the cell line was modified by using CRISPR/Cas9 technology to establish a novel CHO cell expression system, which remarkably improved the expression level of recombinant proteins and laid the foundation for the large-scale production of recombinant proteins.

In recent years, the biopharmaceutical industry is growing rapidly, among which recombinant proteins play a huge role in the prevention and treatment of diseases such as cancer, infectious diseases, autoimmunity, endocrine metabolism and nervous system. The global biopharmaceutical market is predicted to reach $3.89 billion by 20241. For more than a decade, mammalian cells, especially Chinese hamster ovary (CHO) cells, have been increasingly used as a production platform to produce recombinant therapeutic proteins, which can produce properly folded, glycosylated recombinant proteins. CHO cells have several advantages over other cell types, such as their ability to grow stably in a chemically defined and serum-free medium (SFM), relative safety against replication of human pathogenic viruses, and the ability to express recombinant proteins with human-like post-translational modifications2,3. Although considerable progress has been made in increasing the specific and volumetric yields of cells using media optimization, process improvement, and genetic engineering4,5, there are limitations on expressing difficult-to-express proteins with low titers or improper folding compared with biomanufacturing standards6. In addition, the ease of generating engineered cell clones is an important feature of CHO cells, which can achieve high protein expression level by inserting target genes into the host cell genome through site-specific or random integration, followed by gene amplification using dihydrofolate reductase or glutamine synthetase (GS) knockout systems7,8.

Gene sequence optimization can adjust the GC content of genes, prevent base repeats, eliminate restriction endonuclease recognition sites, and avoid similarities to important RNA motifs located in open-reading frames, as they may cause ribosomal pause that interferes with mRNA processing and translation, apart from factors such as CpG content and TATA cassette9. Another 5′ untranslated region, a regulatory element, inserted into the RNA hairpin structure, also enhances expression10. Apart from gene sequence optimization, sequence motifs affect the rate of LC-HC dimerization during monoclonal antibody synthesis, resulting in product-specific yield differences11.

The Kozak sequence is named after the extensive research of Marilyn Kozak, who first discovered the importance of nucleotides upstream of the start codon12. In guiding the transition of ribosome-recognized eukaryotic transcripts, the Kozak sequence was identified as GCCGCCRCC in 198713, which clearly provided good translation efficiency compared with other sequence, and the − 6 to − 1 sequences of GCCRCC were defined as the strong Kozak sequence that provides efficient translation14,15. Research showed that vertebrate species-specific variation in the Kozak consensus affected the expression efficiency in the zebrafish model. The researchers found that the Kozak consensus unique to zebrafish showed a twofold increase in translation efficiency compared with the classical Kozak sequence, although only two nucleotides differed16. The Kozak sequence is a nucleic acid sequence behind the 5 ‘cap structure of eukaryotic mRNA, usually GCCACCAUGG, which can bind to translation initiation factors to mediate the translation initiation of mRNA containing the 5’ cap structure. Moreover, the Kozak sequence can also affect the translation efficiency of protein synthesis17.

Leader sequence, also known as the leader peptide, is a type of signal peptide that plays a role in protein folding, which is cleaved automatically or by some external proteases. Leader sequence has different lengths and positions on different proteins, such as the leader sequence of Bacillus subtilis protease E located at the N-terminus of the protein, the sequence of the IgA protease located at the C-terminus, and proteins that are N-terminal and C-terminus, such as serine proteases18,19. Protein function may be modified by altering the structure of the leader peptide, which is often highly conserved in its catalytic domain, and the biological properties of the protein can be changed without altering this domain20,21. The role of leader sequence is to initiate the transmission of information and targeting in the process of protein synthesis.

The development of more cell lines and processes is necessary to obtain stable clones with desirable production characteristics, which will increase protein yields22. Improving cell engineering for transient production can not only increase the expression level of difficult-to-express proteins, but also alter the host cell background to improve strong indicators of robust performance. Systems and synthetic biology tools can also remarkably improve the ability to produce recombinant proteins, allowing for improved transient and stable production performance on a product-specific basis23. The use of CRISPR/Cas9 technology to accurately knock out certain key genes and to optimize culture processes can improve protein expression levels.

The inhibition of the apoptotic pathway of cells could increase the expression level of recombinant proteins. Apoptotic protease activating factor 1 (Apaf1) is a human homolog of Caenorhabditis elegans CED-4, suggesting ways to identify CED-4 and its underlying genes. Apaf1 is a 130 kDa protein that contains an N-terminal CARD domain, a region homologous to CED-4, and a C-terminal domain containing multiple WD-40 repeat sequences. In the presence of dATP and cytochrome c (Cyt c), Apaf1 forms a large apoptotic complex (700–1400 kDa) by oligomerization. This complex binds to procaspase-9 and activates its activity, which in turn initiates a cascade to activate downstream components, thereby promoting apoptosis24 and increasing recombinant protein yields. The main component of the apoptotic vesicle is Apaf1, a multi-domain protein that is activated upon binding to Cyt c released upon the infiltration of the outer mitochondrial membrane25. A few proteins have been shown to interact with Apaf1 or determine its activity as an apoptotic adaptor. Mochizuki et al.26 reported that the delivery of the adeno-associated viral vector-based dominant inhibitor Apaf1 inhibited the apoptosis-mediated neuronal degeneration in the substantia nigra striatal neurons in the MPTP model of Parkinson’s disease. Gao et al.27 inhibited Apaf1 in an animal model of neonatal hypoxic–ischemic brain injury by overexpressing the Apaf1-specific inhibitory protein, resulting in attenuated brain tissue loss. Ferraro et al.28 demonstrated that Apaf1-deficient cells can initiate a realignment of metabolic pathways, although the mitochondrial depolarization state is restored, thereby surviving the stimulation of apoptosis.

A single protocol may improve protein expression; however, in establishing a novel expression system, a synergistic approach is necessary to address the bottleneck of low protein expression level and to improve the yield of recombinant proteins. Based on the abovementioned research background, this project optimizes a novel CHO cell expression system by optimizing the vector and establishing an Apaf1 knockout CHO cell line. In the design of the vector, a regulatory sequence is added upstream of the target protein in the parent vector to increase the expression level of the recombinant protein, and an apoptotic gene is knocked out to make the cells anti-apoptotic. Consequently, the proportion of apoptotic cells is reduced, and the expression level of the recombinant protein is increased. Combining vector optimization with cell line modification strategies can maximize the expression of recombinant proteins.

The two expression vectors pCMV-eGFP-1 and pCMV-eGFP-2 (Fig. S1A–C) were successfully constructed using pCMV-eGFP-F2A-RFP as the backbone vector (pCMV-eGFP), and the Kozak sequence and combined sequence of Kozak and Leader were added upstream of eGFP, which were further confirmed by sequencing. The abovementioned three vectors were transfected with CHO-S cells, and after 48 h, the green fluorescence was observed and compared under an inverted fluorescence microscope. In addition, the MFI values of eGFP were detected by flow cytometry. Compared with the control group and control vector (pCMV-eGFP), pCMV-eGFP-1 and pCMV-eGFP-2 were increased by 1.26- and 2.2-fold, respectively (Fig. 1).

Effect of adding regulatory elements on the transient expression of eGFP. The optimized vectors were transfected into CHO-S cells, and the transient expression of eGFP was observed under fluorescence microscopy for 48 h, and the cell pellet was collected, and the MFI value of eGFP was detected by flow cytometry. The above data were from three independent experiments, and the difference was considered statistically significant when P < 0.05. *P < 0.05 and **P < 0.01 compared to the control group.

To explore the effect of regulatory elements on the expression of recombinant proteins, pCMV-SEAP-F2A-RFP-Blasticidin was used as the backbone vector (pCMV-SEAP), and the Kozak sequence and the combined sequence of Kozak and Leader were added to the upstream of SEAP, and the two expression vectors pCMV-SEAP-1 and pCMV-SEAP-2 were successfully constructed (Fig. S1D–F). After 48 h of transfection with the abovementioned vectors, red fluorescence was observed and compared under an inverted fluorescence microscope (Fig. 2A). Three wells of each cell were expanded to a six-well plate suspension to detect the transient expression results, and three wells of each cell were screened with a DMEM/F12 complete medium containing Blasticidin to obtain a stable cell pool, which is suspended to detect stable expression results. The transient expression results of the alkaline phosphatase kit showed that pCMV-SEAP-1 and pCMV-SEAP-2 were 1.37- and 1.4-fold higher than pCMV-SEAP, respectively. The stable expression results indicated that pCMV-SEAP-1 and pCMV-SEAP-2 were 1.49- and 1.55-fold higher than pCMV-SEAP, respectively (Fig. 2C).

Effect of the addition of regulatory elements on the transient and stable expression of recombinant proteins. (A) Comparison of red fluorescence after 48 h transfection of CHO-S cells with three SEAP-expressing vectors; (B) comparison of red fluorescence after transfection of CHO-S cells with three IL-3-expressing vectors for 48 h; (C) comparison of transient and stable expression of SEAP; (D) comparison of transient and stable expression of IL-3. The above data were from three independent experiments, and the difference was considered statistically significant when P < 0.05. *P < 0.05 and **P < 0.01 compared to the control group.

To verify the increase of the expression level of the recombinant protein by the addition of regulatory elements, IL-3 was replaced with SEAP, and three expression vectors pCMV-IL3, pCMV-IL3-1, and pCMV-IL3-2 were successfully constructed (Fig. S1G–I). The abovementioned three vectors were transfected with CHO-S cells. After 48 h, red fluorescence was observed and compared under an inverted fluorescence microscope (Fig. 2B). Three wells of each cell were expanded to a six-well plate suspension to detect the transient expression results, and three wells of each cell were screened with a DMEM/F12 complete medium containing rice to obtain a stable cell pool. The stable expression results were detected by suspending the cells. The transient expression detection results of pCMV-IL3-1 and pCMV-IL3-2 were 1.27- and 1.39-fold higher than those of pCMV-IL3, respectively, and the stable expression detection results of pCMV-IL3-1 and pCMV-IL3-2 were 1.43- and 1.62-fold higher than those of pCMV-IL3, respectively (Fig. 2D).

Taking the murine genome sequence as the target, the Apaf1 genome sequence was queried, and the mRNA genome sequence showed three transcripts. The common exon sequences of the three transcripts were selected for the design of sgRNA, and the second exon of the mRNA genome sequence was selected as the knockout target to increase the probability of frameshift mutations. An online design website (crispor.tefor.net) was used to design sgRNA targets for the Apaf1 gene. The CRISPR/Cas9 system expression vector PX459 was linearized using the restriction enzyme BbsI (Fig. S2), and the sgRNA and linearized Cas9 vector were incubated, ligated, and sequenced. The sequencing results are shown in Fig. S3. The results indicated that PX459 was successfully ligated with sgRNA, and the vector was labeled as PX459-Apaf1.

PX459-Apaf1 was transfected into CHO-S cells to knock out the Apaf1 sequence in CHO cells. After 48 h, a stable cell pool was obtained by puromycin screening. In addition, five monoclonal strains were obtained by monoclonal screening using limiting dilution. Intracellular genomic DNA was also extracted. After PCR amplification, DNA bands were analyzed by agarose gel electrophoresis (Fig. 3A). Considering that the length of PCR primers was approximately 300 bp, clone 3 and clone 4 could be preliminarily determined, which are monoclonal strains with successful knockout, namely, CHO-KO-1, CHO-KO-2, and CHO-KO-3. The DNA of the abovementioned three monoclonal strains was extracted and sequenced. The sequencing results are shown in Fig. S4. The results indicated that the abovementioned three monoclonal strains were successfully knocked out.

Knockout and validation of Apaf1 gene in CHO cells. (A) PCR amplification results of Apaf1 knockout monoclonal cell line of CHO cells, the PCR amplification products of clone 1 and clone 2 were about 500 bp, and the PCR amplification products of clone 3, 4 and 5 were about 300 bp, which matched the primer length designed in this experiment; (B) comparison of the relative mRNA expression levels of Apaf1 gene in CHO-WT cells and CHO-KO cells; (C) comparison of Apaf1 gene protein expression levels between CHO-WT cells and CHO-KO-1, -2 and − 3 cells; (D) statistical analysis of Western blot results using Image J software. The above data were from three independent experiments, when P < 0.05, the difference is statistically significant, compared with CHO-WT, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

RNA of CHO-WT, CHO-KO-1, CHO-KO-2, and CHO-KO-3 was extracted, and reverse transcription reaction was conducted to obtain cDNA. The results of qPCR detection of the CHO-Apaf1-KO monoclonal cell line indicated that the mRNA expression level of Apaf1 in the CHO-Apaf1-KO monoclonal cell line was remarkably lower than that of CHO-WT cells (Fig. 3B).

The intracellular proteins of CHO-WT, CHO-KO-1, CHO-KO-2, and CHO-KO-3 were extracted, and the cells were lysed using an ultrasonic cell disruptor. Protein levels were verified by Western blot. The results indicated that the protein expression level of CHO-KO-1 was slightly lower, and the protein levels of CHO-KO-2 and − 3 were significantly lower than that of the CHO-WT cell. The sequencing results indicated the successful knockout of the Apaf1 gene in CHO cells (Fig. 3C, D).

The three cell lines of CHO-WT and CHO-KO were expanded and cultured in a serum-free suspension medium for 7 days. The cell viability and VCD were measured daily. As shown in Fig. 4A, knocking out the Apaf1 gene in CHO cells had no effect on cell growth compared with the cell density of wild-type CHO cells. During the 7-day suspension period, the cell viability of knockout cell lines and wild-type CHO cells was observed daily, and the cell viability of the knockout Apaf1 gene and wild-type CHO cells was maintained at more than 95% (Fig. 4B).

Effect of Apaf1 knockout on CHO cell growth. During the suspension culture of the three cell lines of CHO-WT and CHO-KO, the cell viability and viable cell density were measured by taking a portion of the cells every day. (A) Viable cell density; (B) cell viability.

The cell pellet of CHO-WT and CHO-KO was collected and stained in accordance with the instructions of the apoptosis kit, and apoptosis was detected by flow cytometry. The proportion of apoptotic cells was 14.24% in CHO-WT (Fig. 5A), and the proportion of apoptotic cells in CHO-KO-1, -2, and − 3 accounted for 6.81%, 4.47%, and 2.47%, respectively (Fig. 5B–D). These results indicate that the proportion of apoptotic cells in CHO cells with Apaf1 knockout is lower than that in CHO-WT (Fig. 5E).

Effect of Apaf1 knockout on apoptosis. (A) CHO-WT; (B) CHO-KO-1; (C) CHO-KO-2; (D) CHO-KO-3. (E) The above data were from three independent experiments, and the difference was considered statistically significant when P < 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 compared with CHO-WT.

Based on the abovementioned results, three monoclonal cells were knocked out, and the CHO-KO-3 cell line was selected for subsequent experiments. pCMV-eGFP, pCMV-eGFP-1, and pCMV-eGFP-2 were transfected into CHO-WT and CHO-KO cells, and the eGFP fluorescence was observed under an inverted fluorescence microscope 48 h later. In CHO-WT cells, the fluorescence of pCMV-eGFP-1 and pCMV-eGFP-2 was stronger than that of pCMV-eGFP, and the green fluorescence of each group was remarkably enhanced in CHO-KO cells compared with CHO-WT (Fig. 6).

Comparison of transient expression of eGFP in CHO-WT and CHO-KO cells. The optimized vector was transfected into CHO-WT and KO cells, respectively, and the transient expression of eGFP was observed under fluorescence microscopy 48 h later.

Three SEAP-expressing vectors (pCMV-SEAP, pCMV-SEAP-1, and pCMV-SEAP-2) and three IL-3-expressing vectors (pCMV-IL3, pCMV-IL3-1, and pCMV-IL3-2) were transfected into CHO-WT and CHO-KO cells. After 48 h of transfection, each cell was expanded to a six-well-plate suspension culture to detect transient expression results. In addition, three wells of each cell were screened with a DMEM/F12 complete medium containing Blasticidin to obtain a stable cell pool, which was suspended to detect stable expression.

The alkaline phosphatase kit was used to detect SEAP activity, and the detection results of the transient expression of SEAP are shown in Fig. 7A. In addition, the SEAP concentrations in pCMV-SEAP, pCMV-SEAP-1, and pCMV-SEAP-2 transfected into CHO-KO cells were increased by 1.74-, 1.75-, and 1.71-fold, respectively. The detection results of the stable expression of SEAP are shown in Fig. 7C, and the SEAP concentrations in pCMV-SEAP, pCMV-SEAP-1, and pCMV-SEAP-2 transfected into CHO-KO cells were 1.85-, 1.93-, and 2.16-fold higher than those of CHO-WT cells, respectively.

Comparison of transient and stable expression levels and relative copy number of SEAP in CHO-WT and CHO-KO cells. The optimized vectors were transfected into different cell lines, and the transient transfection and stable transfection expression of SEAP were detected, and the relative gene copy number was analyzed. (A) Comparison of transient expression of SEAP in CHO-WT and CHO-KO cells. (B) Comparison of gene copy number of transiently expressed SEAP in CHO-WT and CHO-KO cells. (C) Comparison of stable expression of SEAP in CHO-WT and CHO-KO cells. (D) Comparison of gene copy number of stably expressed SEAP in CHO-WT and CHO-KO cells. The above data were from three independent experiments, when P < 0.05, the difference is statistically significant, compared with CHO-WT, *P < 0.05, **P < 0.01, ***P < 0.001.

The human IL-3 ELISA kit was used to detect IL-3 concentration, and the results of the transient expression of IL-3 are shown in Fig. 8A. The SEAP concentrations in pCMV-IL3, pCMV-IL3-1, and pCMV-IL3-2 transfected into CHO-KO cells were increased by 1.68-, 1.61-, and 1.52-fold, respectively. The detection results of the stable expression of IL-3 are shown in Fig. 8C, and the IL-3 concentrations in pCMV-IL3, pCMV-IL3-1, and pCMV-IL3-2 transfected into CHO-KO cells were 1.73-, 1.87-, and 1.86-fold higher than those of CHO-WT cells, respectively.

Comparison of transient and stable expression levels and relative copy number of IL-3 in CHO-WT and CHO-KO cells. The optimized vectors were transfected into different cell lines, and the transient transfection and stable transfection expression of IL-3 were detected, and the relative gene copy number was analyzed. (A) Comparison of transient expression of IL-3 in CHO-WT and CHO-KO cells. (B) Comparison of gene copy number of transiently expressed IL-3 in CHO-WT and CHO-KO cells. (C) Comparison of stable expression of IL-3 in CHO-WT and CHO-KO cells. (D) Comparison of gene copy number in stably expressed IL-3 in CHO-WT and CHO-KO cells. The above data were from three independent experiments, when P < 0.05, the difference is statistically significant, compared with CHO-WT, *P < 0.05, **P < 0.01.

In exploring the mechanism of the increase in the expression of recombinant proteins, total DNA was extracted from cells that transiently expressed SEAP and IL-3 and stably expressed SEAP and IL-3 (CHO-WT and CHO-KO). In addition, the gene copy number was analyzed (Figs. 7B and D and 8B and D). The copy numbers of transiently transfected pCMV-SEAP, pCMV-SEAP-1, and pCMV-SEAP-2 in CHO-KO cells were 0.7-, 1.7-, and 0.69-fold higher than those of CHO-WT cells, respectively, and the copy numbers of transiently transfected pCMV-IL3, pCMV-IL3-1, and pCMV-IL3-2 in CHO-KO cells were 0.61-, 0.49-, and 1.59-fold higher than those of CHO-WT cells, respectively. However, the copy numbers of the three vectors stably expressing SEAP in CHO-KO cells were 3.32-, 4.27-, and 3.09-fold higher than those in CHO-WT cells. The copy numbers of the three vectors stably expressing IL-3 in CHO-KO cells were 2.51-, 3.9-, and 2.15-fold higher than those in CHO-WT cells. The copy number analysis results indicated that the transient expression of SEAP and IL-3 is not closely related to the gene copy number, but the expression level of SEAP and IL-3 increases after stable screening of the cell pool, and the copy number also increases. Therefore, the expression level of the stable expression of SEAP and IL-3 in CHO-KO cells is related to the gene copy number compared with that of CHO-WT cells, and the increase of transient expression level is independent of the gene copy number.

Recombinant proteins, especially therapeutic proteins, have been used to treat different diseases, including several types of cancer. Thus, the pharmaceutical industry has increasingly attempted to produce more protein-based drugs29. The development of this protein therapy requires the use of mammalian cell lines, not bacteria or yeast. Mammalian cells typically fold and glycosylate these drugs. At present, the cells used in the production of biopharmaceuticals include human embryonic kidney-293, NS0 (mouse myeloma-derived cells), young mouse kidney (BHK), PER-C6 (human retina), and CHO cells30. At present, most recombinant protein drugs are produced in CHO cell lines, because of their safety in humans, biosimilar glycosylation patterns, kinetic systems for gene amplification, and simple adaptability in suspension. Therefore, CHO cells remain the commonly used mammalian host, facilitating large-scale culture31. Despite these advantages, the rapid development of cell lines to produce therapeutic proteins remains an important concern.

The use of CRISPR/Cas9 technology, along with donor design strategies, has been pushed into cell line engineering, enabling scientists to modify mammalian genomes quickly, easily, and efficiently, where genes of interest can be combined on a single or multiple loci, or a gene can be knocked out or knocked down using this technique32. Following the pioneering work of Marilyn Kozak, Kozak sequences have been recognized for decades as an important feature for achieving efficient translation. Variation in this sequence has been shown to affect the efficiency of translation and cause diseases in humans. In Drosophila, transcripts with weak Kozak sequences have been found to be enriched in neuron-associated genes, indicating the importance of neuron-related Kozak consensus, which is distinct from other genes. Studies have shown that the effect of Kozak sequences on translational efficiency is related to the elongation and initiation rates of specific cell types33, indicating that the preferred Kozak arrangement may differ from the classical Kozak consensus for a given cell or tissue type. Leader sequences have different lengths and positions on different proteins, resulting in different protein translation efficiency. Therefore, adding the Kozak and Leader sequence may enhance translation efficiency when designing tissue-specific vectors. Although considerable work has been done in the field of CHO cell engineering, CHO cells are currently the preferred target for the large-scale production of therapeutic proteins, and their optimization is still needed31,34.

In this study, a combined sequence construction vector of the regulatory Kozak sequence, as well as the combined sequence of Kozak and Leader, was first added upstream of eGFP, and the intensity of its green fluorescence and relative MFI value was analyzed. The results indicated that the intensity of green fluorescence was remarkably enhanced compared with the control group with the addition of Kozak alone or the combination sequence of Kozak and Leader. eGFP was replaced with IL-3 and SEAP to confirm that the addition of this regulatory sequence could increase protein expression levels. Next, CHO-S cells were transfected with plasmids containing IL-3 and SEAP and then cultured in a suspension at a certain density. The results indicated that the expression level of the protein could be remarkably increased with the addition of regulatory sequences compared with the control, whether it was transient or stably expressed.

Numerous studies have shown that knocking out the GS gene on CHO cells can increase the yield of monoclonal antibodies in CHO cells by pressurized screening35. Therefore, CRISPR/Cas9 was used to knock out Apaf1 in CHO cells. A CHO cell line with Apaf1 knockout was also established. Whether the Apaf1 gene was successfully knocked out on CHO cells was verified by sequencing, mRNA level, and protein level. Finally, three monoclonal cells, namely, CHO-KO-1, CHO-KO-2, and CHO-KO-3, were successfully screened to determine whether Apaf1 knockout influences the biological properties. The results indicated no significant difference in cell growth between Apaf1-knockout CHO cells and wild-type CHO cells, and the proportion of apoptotic cells detected by flow cytometry indicated that knocking out the apoptotic gene could reduce the proportion of apoptotic cells.

The sequencing results indicated that KO-1 cells did not knock out all the genes, but five bases were added to the sequence, and six bases were lost in the cell through gene mutation, resulting in changes in the whole gene and different protein translations, which were temporarily considered as successful knockout. Through sequencing, a base mutation of KO-2 cells occurred in the exome region, from T to A, resulting in a change in the codon. We also identified this situation as a successful knockout. The sequence of KO-3 was missing base C, and a base mutation occurred, from A to T, resulting in a change in the codon behind the base. This case is considered as a successful knockout. The results indicated that the mRNA transcription level of the abovementioned three monoclonal cells was about 10 times lower than that in CHO-WT cells, which further confirmed that Apaf1 was successfully knocked out in CHO cells. Next, the cells were verified at the protein level, and the results indicated that the Apaf1 protein level of KO-1, 2, and 3 cell lines was lower than that of CHO-WT cells compared with CHO-WT cells. Moreover, CHO-KO-3 was the most evident, so the CHO-KO-3 cell line was selected for follow-up experiments.

A novel CHO cell expression system was obtained by establishing the Apaf1 knockout CHO cell line and optimally combining it with the previous vector, and the eGFP, IL-3, and SEAP expression vectors were transfected into CHO-WT and CHO-KO-3 cells to detect the protein expression level. The results of early optimization indicated that compared with the control vector expressing eGFP, the vector with the Kozak sequence, as well as the combined sequence of Kozak and Leader, was increased by 1.26- and 2.2-fold, respectively, and the fluorescence of pCMV-eGFP, pCMV-eGFP-1, and pCMV-eGFP-2 transfected with CHO-KO was remarkably enhanced compared with CHO-WT when expressing eGFP using the novel CHO cell expression system.

After vector optimization, SEAP vectors with the Kozak sequence, as well as the combined sequence of Kozak and Leader, increased the transient expression by 1.37- and 1.4-fold and the stable expression by 1.49- and 1.55-fold, respectively, compared with the SEAP control vector. Compared with the IL-3 control vector, the transient expression of the IL-3 vector with the Kozak sequence and the combined sequence of Kozak and Leader was increased by 1.27- and 1.39-fold, whereas the stable expression was increased by 1.43- and 1.62-fold, respectively.

Compared with CHO-WT cells, the transient expression of pCMV-SEAP, pCMV-SEAP-1, and pCMV-SEAP-2 was increased by 1.74-, 1.75-, and 1.71-fold, respectively, and the stable expression of pCMV-IL3 was increased by 1.85-, 1.93-, and 2.16-fold. Compared with CHO-WT, the transient expression of pCMV-IL3-1 and pCMV-IL3-2 was increased by 1.68-, 1.61-, and 1.52-fold, and the stable expression was increased by 1.73-, 1.87-, and 1.86-fold. The abovementioned experimental results indicate that the SEAP protein is suitable for inserting the combined sequence of Kozak and Leader upstream of the SEAP protein, and for IL-3 protein, the Kozak sequence can be inserted separately upstream of it. Therefore, different vector optimization schemes can be adopted for different target proteins, and the addition of regulatory sequences can remarkably improve the expression level of recombinant proteins. Based on the copy number analysis results, the transient expression levels of SEAP and IL-3 are not closely related to the gene copy number. However, in stable expression, with the increase of the expression levels of SEAP and IL-3, the copy number of genes increases, which indicates that the stable expression levels of SEAP and IL-3 in CHO-KO cells are related to the copy number of genes compared with those of CHO-WT cells, and the increase of transient expression level does not depend on the copy number of genes.

In recent years, researchers have exerted considerable effort to improve the expression of recombinant proteins36,37,38. Gene modification and sequence optimization are a good strategy. The results indicated that different sequence optimizations could lead to different degrees of improvement of recombinant proteins, and cell line modification was a common strategy to improve protein expression levels. In this study, the fluorescence of reporter gene eGFP was enhanced by adding different regulatory sequences to the upstream of target gene, and the protein expression level was also increased by replacing eGFP with different proteins such as SEAP and IL-3. The knockout of the apoptosis gene Apaf1 can reduce the proportion of apoptotic CHO cells, and the survival rate of CHO cells can be higher. In our future studies, we can express some difficult-to-express proteins with the established novel CHO cell expression system, which lays the foundation for the large-scale production of recombinant proteins.

Based on the vector (pCMV-eGFP-F2A-RFP) expressing enhanced green fluorescent protein (eGFP) in the previous study of our laboratory39, the Kozak sequence and the combination sequence of Kozak and Leader were added into the upstream of the reporter gene eGFP in a seamless cloning manner, which were labeled as pCMV-eGFP (pCMV-eGFP-F2A-RFP), pCMV-eGFP-1 (pCMV-Kozak-eGFP-F2A-RFP), and pCMV-eGFP-2 (pCMV-Kozak-Leader-eGFP-F2A-RFP). Based on the vector (pCMV-SEAP-F2A-RFP-Blasticidin) expressing secreted alkaline phosphatase (SEAP) in our laboratory, the Kozak sequence and the combination sequence of Kozak and Leader were added into the upstream of SEAP in a seamless cloning manner, which were labeled as pCMV-SEAP (pCMV-SEAP-F2A-RFP-Blasticidin), pCMV-SEAP-1 (pCMV-Kozak-SEAP-F2A-RFP-Blasticidin), and pCMV-SEAP-2 (pCMV-Kozak-Leader-SEAP-F2A-RFP-Blasticidin). The SEAP in the three vectors (pCMV-SEAP, pCMV-SEAP-1, and pCMV-SEAP-2) was replaced with the target gene IL-3, which was labeled as pCMV-IL-3 (pCMV-Il-3-F2A-RFP-Blasticidin), pCMV-IL3-1 (pCMV-Kozak-IL-3-F2A-RFP-Blasticidin), and pCMV-IL3-2 (pCMV-Kozak-Leader-IL-3-F2A-RFP-Blasticidin), respectively, and the abovementioned process was completed by General Biol (Anhui) Co., Ltd.

CHO-S cells (ATCC, Manassas, VA, USA) were cultured in DMEM/F12 medium (WISENT, Nanjing, China) supplemented with 10% fetal bovine serum (WISENT, Nanjing, China). CHO-S cells were cultured in a constant-temperature cell culture incubator set at 37 °C with 5% CO2. Before transfection, CHO-S cells were seeded in 24-well plates at a density of 2 × 105 cells/well, and when the cell density reached about 80%, the optimized vector was transfected into CHO-S cells with Lipofectamine 2000 (Biosharp, Hefei, China). After 48 h, Blasticidin (Beyotime, Shanghai, China) was added into the culture medium at a final concentration of 10 µg/mL, and control cells were completely dead. The medium was replaced with 5 µg/mL of a complete medium containing Blasticidin, and the dead cells were screened for 1 week to obtain a stable cell pool.

After transfection for 48 h, transiently expressed cells were resuspended in six-well plates at a density of 5 × 105 cells/mL using CHOPro serum-free medium (Proteineasy, Xinxiang, China) and incubated in an incubator at 37 °C and 5% CO2 with shaking at 120 rpm. For stably expressed cells, the stable cell pool was resuspended at a density of 5 × 105 cells/mL in six-well plates using serum-free medium and incubated at 37 °C and 5% CO2 with shaking at 120 rpm. The viable cell density (VCD) and cell viability were measured using a cell analyzer (Countstar, Shanghai, China).

After transfection of the eGFP-containing plasmid for 48 h, the eGFP fluorescence intensity of each cell was observed under an inverted fluorescence microscope (Nikon ECLIPSE, Nikon, Japan). The cell pellet was collected and resuspended with 500 µL of phosphate-buffered saline (PBS), and the mean fluorescence intensity (MFI) of each eGFP was detected by flow cytometry.

To explore the effect of regulatory elements on the expression of recombinant proteins, eGFP was replaced with SEAP. After transfection of SEAP-containing plasmids into CHO-S cells, cell supernatants were collected from a culture suspended for 7 days, and transient and stable expression of SEAP was detected using an alkaline phosphatase assay kit (Beyotime, Shanghai, China). A total of 50 µL of cell supernatant mixed with 50 µL of chromogenic substrate was added to a 96-well plate; the reaction was performed at 37 °C for 10 min, and 100 µL of the reaction stop solution was added to stop the reaction. The absorbance was determined at 405 nm using a microplate reader, and the SEAP activity in each sample was calculated from the slope (in U/L) using the standard curve obtained from the positive control provided in the kit.

To verify the increase of recombinant protein expression level by adding regulatory elements, IL-3 was substituted for SEAP. After transfecting CHO-S cells with IL-3-containing plasmids, cell supernatants were collected from a culture suspended for 7 days, and transient and stable expression of IL-3 was detected using the human IL-3 ELISA kit (Neobioscience, Shenzhen, China). Using the double-antibody sandwich method, the anti-human IL-3 monoclonal antibody was coated on the microplate label, and the human IL-3 in the specimen and standard will bind to the monoclonal antibody. Then, the free components will be washed away. The biotinylated anti-human IL-3 antibody and horseradish peroxidase-labeled avidin were added. Biotin was specifically bound to avidin to form an immune complex. This solution was added with a chromogenic substrate and incubated at 37 °C for 15–20 min. The OD value was measured at 450 nm, and the concentration of human IL-3 could be found on the standard curve by the OD value of the sample.

Aiming at the murine genome sequence, the Apaf1 genome sequence was queried (http://www.ncbi.nlm.nih.gov), and sgRNA was designed in accordance with the common exon sequence in the transcript. The Apaf1 gene was designed using an online design website (crispor.tefor.net) and labeled as sgRNA1 (CACCGTGGAAGGCCACTATGAAGA). The CRISPR/Cas9 system expression vector PX459 was linearized using the restriction enzyme BbsI, and the sgRNA and linearized Cas9 vector (PX459-Apaf1) were incubated at 16 °C using T4 ligase and ligated overnight. The incubation product was transformed into DH5α competent cells, and the shaking bacteria were sequenced after expansion culture.

The PX459-Apaf1 plasmid was transfected into CHO-S cells in accordance with the abovementioned cell transfection method. After transfection for 48 h, the medium was replaced with a DMEM/F12 complete medium containing puromycin (Beyotime, Shanghai, China) at a concentration of 16 µg/mL and changed every day for 5 days. Normal cells without a transfection plasmid died. In addition, the medium was replaced with a DMEM/F12 complete medium containing puromycin at a concentration of 12 µg/mL for culture every day. Cells were obtained after 14 days of screening pools. Cell pools were expanded, and monoclonal cells were screened using limiting dilution.

Monoclonal cells were expanded, and intracellular genomic DNA was extracted using the Genomic DNA Extraction Kit (Beyotime, Shanghai, China). The upstream and downstream primers, including the knockout site (F: 5′-CTCGGCCTTCTGTGCTTCTT-3′, R: 5′-ACAATCAGACCTGCAAGCAAT-3′) were amplified by PCR, detected by agarose gel electrophoresis, and sequenced.

Intracellular total RNA was extracted by Trizol and reverse transcribed into cDNA (Vazyme, Nanjing, China). The primers for the Apaf1 (F: 5′-CCATACAGGCCATCACAGCA-3′, R: 5′-TGGTCTCCCAGACCCGTATT-3′) and β-actin (F: 5′-GTCGTACCACTGGCATTGTG-3′, R: 5′-AGGGCAACATAGCACAGCTT-3′) were designed. The mRNA levels were detected using the ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China). The relative mRNA levels in each sample were calculated using the 2−ΔΔCt method40.

When the cell density reached 90–100%, cell precipitates were collected. Cells were lysed using an ultrasonic cell disruptor, and loading buffer was added. 10% SDS-PAGE gel was prepared and loaded with 20 µg of protein sample. Electrophoresis detection was performed using fast electrophoresis. The cells were transferred by using a rapid transfer solution (Sevicebio, Wuhan, China) at a constant flow of 400 mA for 30 min, blocked with a rapid blocking solution for about 10 min, and incubated with a primary antibody at 4 °C overnight (1:2000, Abcam, Cambridge, UK). The primary antibody was recovered after 12 h, and the membrane was washed with the pre-prepared TBST three times, 10 min each time. The secondary antibody was incubated for 1.5 h at room temperature (1:20000, Proteintech, Wuhan, China). Subsequently, ECL ultra-sensitive luminescent solution was prepared (Beyotime, Shanghai, China), and the strips were exposed under the exposure machine.

The genomic DNA mini extraction kit (Beyotime, Shanghai, China) was used to extract total DNA from stable cell pools containing SEAP and IL-3, and primers for SEAP, IL-3, and β-actin were designed as follows: SEAP-F: 5′-CCAGATGACTACAGCCAAGGT-3′, SEAP-R: 5′-CTCCACGAAGAGGAAGAAGC-3′; IL3-F: 5′-GGCATTCAACAGGGCTGTCA-3′, IL3-R: 5′-TCATTCCAGTCACCGTCCTTG-3′; β-actin-F: 5′-GTCGTACCACTGGCATTGTG-3′, β-actin-R: 5′-AGGGCAACATAGCACAGCTT-3′. qPCR was used to analyze the relationship between the SEAP relative copy number and SEAP expression level, as well as between the IL-3 relative copy number and IL-3 expression level. The 2−ΔΔCt method was used to calculate the copy number in each sample40.

The adherent cells were trypsinized with EDTA-free trypsin (Solarbio, Beijing, China) and washed two times with PBS. The cells were resuspended in binding buffer, and the controls were set as the single-stain Annexin V-FITC group, single-stain PI group, and double-stain Annexin V-FITC and PI groups, all of which were double stained, incubated in the dark for 10 min, and then prepared for detection in an ice bath (KeyGen, Nanjing, China).

All data were analyzed by GraphPad Prism software, the results were presented as mean \(\:\pm\:\) standard deviation (\(\:\stackrel{-}{x}\text{s}\)), and the significance analysis of experimental data between groups was analyzed by t-test. P < 0.05 was considered statistically significance.

Data is provided within the manuscript or supplementary information files.

Óskarsson, K. R. & Kristjánsson, M. M. Improved expression, purification and characterization of VPR, a cold active subtilisin-like serine proteinase and the effects of calcium on expression and stability. Biochim. Biophys. Acta Proteins Proteom. 1867, 152–162 (2019).

Article PubMed Google Scholar

Du, Q. et al. Effects and mechanisms of animal-free hydrolysates on recombination protein yields in CHO cells. Appl. Microbiol. Biotechnol. 106, 7387–7396 (2022).

Article CAS PubMed Google Scholar

Yang, Y. et al. Increase recombinant antibody yields through optimizing vector design and production process in CHO cells. Appl. Microbiol. Biotechnol. 106, 4963–4975 (2022).

Article CAS PubMed Google Scholar

Geng, S. L. et al. Recombinant therapeutic proteins degradation and overcoming strategies in CHO cells. Appl. Microbiol. Biotechnol. 108, 182 (2024).

Article CAS PubMed PubMed Central Google Scholar

Xu, W. J. et al. Progress in fed-batch culture for recombinant protein production in CHO cells. Appl. Microbiol. Biotechnol. 107, 1063–1075 (2023).

Article CAS PubMed PubMed Central Google Scholar

Amadi, I. M. et al. Inhibition of endogenous miR-23a/miR-377 in CHO cells enhances difficult-to-express recombinant lysosomal sulfatase activity. Biotechnol. Prog. 36, e2974 (2020).

Article CAS PubMed Google Scholar

Ha, T. K. et al. Enhancing CHO cell productivity through a dual selection system using aspg and gs in glutamine free medium. Biotechnol. Bioeng. 120, 1159–1166 (2023).

Article CAS PubMed Google Scholar

Jarusintanakorn, S. et al. Effect of adenosine and cordycepin on recombinant antibody production yields in two different Chinese hamster ovary cell lines. Biotechnol. Prog. 40, e3403 (2024).

Article CAS PubMed Google Scholar

Li, Z. M. et al. Factors affecting the expression of recombinant protein and improvement strategies in Chinese hamster ovary cells. Front. Bioeng. Biotechnol. 10, 880155 (2022).

Article PubMed PubMed Central Google Scholar

Eisenhut, P. et al. Systematic use of synthetic 5’-UTR RNA structures to tune protein translation improves yield and quality of complex proteins in mammalian cell factories. Nucleic Acids Res. 48, e119 (2020).

Article CAS PubMed PubMed Central Google Scholar

Lee, Z. et al. Gene copy number, gene configuration and LC/HC mRNA ratio impact on antibody productivity and product quality in targeted integration CHO cell lines. Biotechnol. Prog. 40, e3433 (2024).

Article CAS PubMed Google Scholar

Kozak, M. Point mutations close to the AUG initiator codon affect the efficiency of translation of rat preproinsulin in vivo. Nature 308, 241–246 (1984).

Article ADS CAS PubMed Google Scholar

Kozak, M. An analysis of 5’-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15, 8125–8148 (1987).

Article CAS PubMed PubMed Central Google Scholar

Kozak, M. At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 196, 947–950 (1987).

Article CAS PubMed Google Scholar

Ambrosini, C. et al. Translational enhancement by base editing of the Kozak sequence rescues haploin sufficiency. Nucleic Acids Res. 50, 10756–10771 (2022).

Article CAS PubMed PubMed Central Google Scholar

McClements, M. E. et al. An analysis of the Kozak consensus in retinal genes and its relevance to gene therapy. Mol. Vis. 27, 233–242 (2021).

CAS PubMed PubMed Central Google Scholar

Li, Z. M. et al. Optimization of extended Kozak elements enhances recombinant proteins expression in CHO cells. J. Biotechnol. 392, 96–102 (2024).

Article CAS PubMed Google Scholar

Liu, Y. et al. A novel approach for improving the yield of Bacillus subtilis transglutaminase in heterologous strains. J. Ind. Microbiol. Biotechnol. 41, 1227–1235 (2014).

Article CAS PubMed Google Scholar

Ayalew, S. et al. Mannheimia haemolytica IgA-specific proteases. Vet. Microbiol. 239, 108487 (2019).

Article CAS PubMed Google Scholar

Demidyuk, I. V. et al. Propeptides as modulators of functional activity of proteases. Biomol. Concepts 1, 305–322 (2010).

Article CAS PubMed Google Scholar

Saify Nabiabad, H., Amini, M. & Kianersi, F. Ipomoea batatas: papain propeptide inhibits cysteine protease in main plant parasites and enhances resistance of transgenic tomato to parasites. Physiol. Mol. Biol. Plants 25, 933–943 (2019).

Article CAS PubMed PubMed Central Google Scholar

Boulenouar, H. et al. Strategy for developing a stable CHO cell line that produces large titers of trastuzumab antibody. Front. Biosci. (Elite Ed.) 15, 24 (2023).

Article CAS PubMed Google Scholar

Donaldson, J., Kleinjan, D. J. & Rosser, S. Synthetic biology approaches for dynamic CHO cell engineering. Curr. Opin. Biotechnol. 78, 102806 (2022).

Article CAS PubMed Google Scholar

Gortat, A. et al. Apaf1 inhibition promotes cell recovery from apoptosis. Protein Cell 6, 833–843 (2015).

Article CAS PubMed PubMed Central Google Scholar

Srinivasula, S. M. et al. Autoactivation of procaspase-9 by apaf-1-mediated oligomerization. Mol. Cell 1, 949–957 (1998).

Article CAS PubMed Google Scholar

Mochizuki, H. et al. An AAV-derived Apaf-1 dominant negative inhibitor prevents MPTP toxicity as antiapoptotic gene therapy for Parkinson’s disease. Proc. Natl. Acad. Sci. U.S.A. 98, 10918–10923 (2001).

Article ADS CAS PubMed PubMed Central Google Scholar

Gao, Y. et al. Neuroprotection against hypoxic-ischemic brain injury by inhibiting the apoptotic protease activating factor-1 pathway. Stroke 41, 166–172 (2010).

Article PubMed Google Scholar

Ferraro, E. et al. Apoptosome-deficient cells lose cytochrome c through proteasomal degradation but survive by autophagy-dependent glycolysis. Mol. Biol. Cell. 19, 3576–3588 (2008).

Article CAS PubMed PubMed Central Google Scholar

Sharker, S. M. & Rahman, A. A review on the current methods of Chinese hamster ovary (CHO) cells cultivation for the production of therapeutic protein. Curr. Drug Discov. Technol. 18, 354–364 (2021).

Article CAS PubMed Google Scholar

Vergara, M. et al. Endoplasmic reticulum-associated rht-PA processing in CHO cells: influence of mild hypothermia and specific growth rates in batch and chemostat cultures. PLoS ONE 10, e0144224 (2015).

Article PubMed PubMed Central Google Scholar

Chu, L. & Robinson, D. K. Industrial choices for protein production by large-scale cell culture. Curr. Opin. Biotechnol. 12, 180–187 (2001).

Article CAS PubMed Google Scholar

Amiri, S. et al. CRISPR-interceded CHO cell line development approaches. Biotechnol. Bioeng. 120, 865–902 (2023).

Article CAS PubMed Google Scholar

Acevedo, J. M. et al. Changes in global translation elongation or initiation rates shape the proteome via the Kozak sequence. Sci. Rep. 8, 4018 (2018).

Article ADS PubMed PubMed Central Google Scholar

Kim, J. Y., Kim, Y. G. & Lee, G. M. CHO cells in biotechnology for production of recombinant proteins: current state and further potential. Appl. Microbiol. Biotechnol. 93, 917–930 (2012).

Article CAS PubMed Google Scholar

Srila, W. et al. Glutamine synthetase (GS) knockout (KO) using CRISPR/Cpf1 diversely enhances selection efficiency of CHO cells expressing therapeutic antibodies. Sci. Rep. 13, 10473 (2023).

Article ADS CAS PubMed PubMed Central Google Scholar

Boukari, I. et al. Strategies for improving expression of recombinant human chorionic gonadotropin in Chinese hamster ovary (CHO) cells. Protein Expr. Purif. 225, 106596 (2025).

Article CAS PubMed Google Scholar

Madabhushi, S. R. et al. Enhancing protein productivities in CHO cells through adenosine uptake modulation-novel insights into cellular growth and productivity regulation. N. Biotechnol. 83, 163–174 (2024).

Article CAS PubMed Google Scholar

Lenser, M. et al. Evaluation of two transposases for improving expression of recombinant proteins in Chinese hamster ovary cell stable pools by co-transfection and supertransfection approaches. Biotechnol. Prog. 17, e3496 (2024).

Article Google Scholar

Zhang, J. et al. Novel and effective screening system for recombinant protein production in CHO cells. Sci. Rep. 14, 20856 (2024).

Article CAS PubMed PubMed Central Google Scholar

Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408 (2001).

Article CAS PubMed Google Scholar

Download references

This work was supported by the National Natural Science Foundation of China (No. U1604193, 32101232), Key Research Projects of Higher Education Institutions of Henan Province (No. 23A310015), Open Program of International Joint Research Laboratory for Recombinant Pharmaceutical Protein Expression System of Henan (No. KFKTYB202205), College Students Innovation and Entrepreneurship Program (No. 202410472027).

These authors contributed equally: Junhe Zhang and ChenyangDu.

Institutes of Health Central Plains, Xinxiang Key Laboratory for Tumor Drug Screening and Targeted Therapy, Xinxiang Medical University, Xinxiang, 453003, China

Junhe Zhang & Chenyang Du

International Joint Research Laboratory for Recombinant Pharmaceutical Protein Expression System of Henan, Xinxiang Medical University, No. 601 Jinsui Road, Xinxiang, 453003, Henan, China

Junhe Zhang, Chenyang Du & Tianyun Wang

Xinxiang Medical University, Xinxiang, 453003, China

Junhe Zhang, Yue Pan, Zhan Zhang, Ruoyuan Feng, Mengyao Ma & Tianyun Wang

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

ZJH, WTY and DCY wrote the main manuscript text , and PY, ZZ, FRY and MMY prepared Figs. 1, 2 and 3. All authors reviewed the manuscript.

Correspondence to Junhe Zhang or Tianyun Wang.

The authors declare no competing interests.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Below is the link to the electronic supplementary material.

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

Zhang, J., Du, C., Pan, Y. et al. Optimization of a novel expression system for recombinant protein production in CHO cells. Sci Rep 14, 24913 (2024). https://doi.org/10.1038/s41598-024-76995-6

Download citation

Received: 30 June 2024

Accepted: 18 October 2024

Published: 22 October 2024

DOI: https://doi.org/10.1038/s41598-024-76995-6

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative